Transcript Information: R_Transcript_38804.p1


Annotated TAIR IDAT2G27380.1
Annotated Gene Nameextensin proline-rich 1
Annotated Gene Symbol(s)ATEPR1, EPR1
Annotation TypeHomolog
Chromosome Positionchr2:11713411-11715696 | Forward length=761
E-Value1E-12
Link to Arabidopsis eFP Browser 2.0


Transcripts Per Million


Condition 1: 0 Hour
Replicate 10
Replicate 20.14091476789462
Replicate 30.15373649393391
Condition 2: 8 Hour
Replicate 10
Replicate 20
Replicate 30
Condition 3: 24 Hour
Replicate 10
Replicate 21.1841749739907
Replicate 30.73448673445964


Fold Change




FASTA Sequences

Nucleotide Sequence

>R_Transcript_38804.p1 GENE.R_Transcript_38804~~R_Transcript_38804.p1 ORF type:internal len:149 (+),score=5.26 R_Transcript_38804:2-445(+)
GACACTCCCCCACCCCAGACCCCTCCGCCCACCCAAACTCCTCCAACCTATCCTCCTCCCCCGACTCAGACCCCTCCCCCCACCGAAGCCCCTCCAACCTATACTCCTCCCCCGACCGAGACCCCTCCCCCCACCGAAGCCCCTCCAACCTATACTCCTCCCCCGACCGAGACCCCTCCACCCACCGAAGCCCCTCCAACCTATACTCCCCCCCCGACCGAGACCCCTCCACCCACCGAAGCCCCTCCAACCTATACTCCCCCCCCGACTGAGACCCCTCCACCCGAGACCCCTCCACCCACCGAAGCCCCTCCAACCTATACTCCCCCCCCGACTGAGACCCCTCCACCCACCGAAGCCCCTCCAACCTATACTCCTCCCCCGACCGAGACCCCTCCACCCACCGAAGCCCCTCCACCCTCTACTCCTCCCCCGACCGAGACC

Click here to download the sequence:
Link to NCBI Nucleotide BLAST

Protein Sequence

>R_Transcript_38804.p1 GENE.R_Transcript_38804~~R_Transcript_38804.p1 ORF type:internal len:149 (+),score=5.26 R_Transcript_38804:2-445(+)
DTPPPQTPPPTQTPPTYPPPPTQTPPPTEAPPTYTPPPTETPPPTEAPPTYTPPPTETPPPTEAPPTYTPPPTETPPPTEAPPTYTPPPTETPPPETPPPTEAPPTYTPPPTETPPPTEAPPTYTPPPTETPPPTEAPPPSTPPPTET

Click here to download the sequence:
Link to NCBI Protein BLAST