Transcript Information: R_Transcript_38808.p1


Annotated TAIR IDAT2G27380.1
Annotated Gene Nameextensin proline-rich 1
Annotated Gene Symbol(s)ATEPR1, EPR1
Annotation TypeHomolog
Chromosome Positionchr2:11713411-11715696 | Forward length=761
E-Value5E-07
Link to Arabidopsis eFP Browser 2.0


Transcripts Per Million


Condition 1: 0 Hour
Replicate 10.18817485520329
Replicate 20
Replicate 30.23615193398095
Condition 2: 8 Hour
Replicate 10.75729479218284
Replicate 20.23052455506377
Replicate 30.37426001279148
Condition 3: 24 Hour
Replicate 11.3017313376533
Replicate 20.56843450748911
Replicate 31.3538786404266


Fold Change




FASTA Sequences

Nucleotide Sequence

>R_Transcript_38808.p1 GENE.R_Transcript_38808~~R_Transcript_38808.p1 ORF type:internal len:194 (+),score=4.63 R_Transcript_38808:2-580(+)
GACACTCCCCCACCCCAGACCCCTCCGCCCACCCAAACTCCTCCAACCTATCCTCCTCCCCCGACTCAGACCCCTCCCCCCACCGAAGCCCCTCCAACCTATACTCCTCCCCCGACCGAGACCCCTCCCCCCACCGAAGCCCCTCCAACCTATCCTCCCCCGACCGAGACCCCTCCCCCCACCGAAGCCCCTCCAACCTATACTCCTCCCCCGACCGAGACCCCTCCACCCACCGAAGCCCCTCCAACCTATACTCCCCCCCCGACCGAGACCCCTCCACCCACCGAAGCCCCTCCAACCTATCCTCCTCCCCCGACTCAGACCCCTCCCCCCACCGAAGCCCCTCCAACCTATACTCCCCCCCCGACCGAGACCCCTCCACCCACCGAAGCCCCTCCAACCTATCCTCCTCCCCCGACTCAGACCCCTCCACCCATCGAAGCCCCTCCAACCTATACTCCCCCCCCGACTGAGACCCCTCCACCCACCGAAGCCCCTCCAACCTATACTCCTCCCCCGACCGAGACCCCTCCACCCACCGAAGCCCCTCCACCCTCTACTCCTCCCCCGACCGAGACC

Click here to download the sequence:
Link to NCBI Nucleotide BLAST

Protein Sequence

>R_Transcript_38808.p1 GENE.R_Transcript_38808~~R_Transcript_38808.p1 ORF type:internal len:194 (+),score=4.63 R_Transcript_38808:2-580(+)
DTPPPQTPPPTQTPPTYPPPPTQTPPPTEAPPTYTPPPTETPPPTEAPPTYPPPTETPPPTEAPPTYTPPPTETPPPTEAPPTYTPPPTETPPPTEAPPTYPPPPTQTPPPTEAPPTYTPPPTETPPPTEAPPTYPPPPTQTPPPIEAPPTYTPPPTETPPPTEAPPTYTPPPTETPPPTEAPPPSTPPPTET

Click here to download the sequence:
Link to NCBI Protein BLAST